Fractional averaging theory for discrete fractional-order system with impulses.

In this paper, we improve the averaging theory on both finite and infinite time intervals for discrete fractional-order systems with impulses. By employing new techniques, generalized impulsive discrete fractional-order Gronwall inequality is introduced. In addition, the closeness of solutions for the discrete fractional-order systems with impulses and the averaged discrete fractional-order systems with impulses is derived. Finally, three examples are provided to illustrate the efficiency of our main results.

An intronic splice-site variant in MBTPS2 underlies ichthyosis follicularis with atrichia and photophobia syndrome.

Ichthyosis follicularis with atrichia and photophobia (IFAP) syndrome is a rare genodermatosis characterized by a classic triad of follicular ichthyosis, alopecia, and photophobia. We report a Chinese patient displaying features of IFAP triad along with painful palmoplantar keratoderma, recurrent infections, periorificial keratotic plaques, nail dystrophy, and pachyonychia. Whole-exome sequencing revealed an intronic variant (NM_015884.3: exon7:c.970+5G>A) in the gene MBTPS2. Sanger sequencing confirmed that the variant segerated with phenotype in the family. Sequencing of cDNAs derived from the patient indicated the variant introduced a new splice donor site, leading to partial skipping of exon 7 (r.951_970del). An in vitro mini-gene assay also revealed abnormal splicing of exon 7. This study presents a case complicated with X-linked IFAP syndrome and Olmsted syndrome, and highlights the significance of using validation assays to identify the pathogenicity of intronic variants in MBTPS2.

Corrigendum: Case report: Challenges in the diagnosis of a case of Mal de Meleda and a therapeutic attempt of ixekizumab and Adalimumab.

[This corrects the article DOI: 10.3389/fmed.2022.821301.].

A novel mutation in SPINK5 gene underlies a case of atypical Netherton syndrome.

Netherton syndrome (NS, OMIM #256500) is a rare autosomal recessive disease characterized by a triad of congenital ichthyosiform erythroderma (CIE) or ichthyosis linearis circumflexa (ILC), trichorrhexis invaginata (TI), and atopic predisposition. The disease is caused by a mutation in the SPINK5 gene (serine protease inhibitor of Kazal type 5) encoding LEKTI (lymphoepithelial Kazal type-related inhibitor). We performed whole-exome sequencing on one Chinese NS family and made genotype-phenotype correlation analysis on the patients clinically diagnosed with NS or congenital ichthyosis erythroderma. We identified a novel frameshift mutation c.2474_2475del (p.Glu825Glyfs*2) in the SPINK5 gene. The N-terminal mutations of LEKTI cause a severer phenotype, while the C-terminal mutations of LEKT1 are related to a milder phenotype. Our findings suggest that Netherton syndrome may be underestimated clinically, and our findings further expand the reservoir of SPINK5 mutations in Netherton syndrome.

Case Report: Challenges in the Diagnosis of a Case of Mal de Meleda and a Therapeutic Attempt of Ixekizumab and Adalimumab.

Background: Mal de Meleda (MDM, OMIM 248300) is an autosomal recessive disease characterized by symmetrical and progressive palmoplantar hyperkeratosis soon after birth. Mutations in SLURP1 gene could lead to MDM. Clinically, MDM is easily misdiagnosed as other types of keratoderma due to phenotypic variation and overlap. Objective and Methods: A patient with suspected MDM was confirmed by the combination of next-generation sequencing and Exomiser, and the patient was attempted with the treatment of Ixekizumab and Adalimumab. Results: A homozygous mutation c.256G>A (p.Gly86Arg) in the SLURP1 gene was identified in the patient. The inflammatory erythemas on his hands, feet and buttocks were mildly relieved after the treatment of high dose of Ixekizumab. Conclusions: Our findings helps to enhance the understanding of MDM. Ixekizumab may be a potential strategy to treat MDM.

Case Report: Chanarin-Dorfman Syndrome: A Novel Homozygous Mutation in ABHD5 Gene in a Chinese Case and Genotype-Phenotype Correlation Analysis.

The Chanarin-Dorfman syndrome (CDS) is a rare, autosomal recessively inherited genetic disease, whch is associated with a decrease in the lipolysis activity in multiple tissue cells. The clinical phenotype involves multiple organs and systems, including liver, eyes, ears, skeletal muscle and central nervous system. Mutations in ABHD5/CGI58 gene have been confirmed to be associated with CDS. We performed whole exome sequencing on a Chinese CDS patient with skin ichthyosis features mimicking lamellar ichthyosis, ectropion, sensorineural hearing loss, and lipid storage in peripheral blood neutrophils. A novel homozygous missense mutation (p.L154R) in ABHD5 gene was detected in this patient. Genotype-phenotype analysis in reported CDS patients revealed no particular correlation. Our findings further enrich the reservoir of ABHD5 mutations in CDS.

Case Report: A Case of Hailey-Hailey Disease Mimicking Condyloma Acuminatum and a Novel Splice-Site Mutation of ATP2C1 Gene.

Hailey-Hailey disease (HHD) is a rare autosomal-dominant blistering disorder characterized by recurrent vesicular and erosive lesions at intertriginous sites. We described a 24-year-old male who presented with multiple bright red verrucous papules in his mons pubis, bilateral groins, scrotum, perineum, and crissum, clinically resembling condyloma acuminatum. The histopathology showed extensive acantholysis with the characteristic appearance of a dilapidated brick-wall. The mutation analysis revealed a novel splice-site mutation in the ATP2C1 gene. The patient was definitely diagnosed with HHD. The antibacterial treatments resulted in a dramatic improvement. Our findings help to broaden the understanding of clinical manifestations of HHD and improve the clinical diagnosis and treatment of this disease.

Food and feed trade has greatly impacted global land and nitrogen use efficiencies over 1961-2017.

International trade of agricultural products has complicated and far-reaching impacts on land and nitrogen use efficiencies. We analysed the productivity of cropland and livestock and associated use of feed and fertilizer efficiency for over 240 countries, and estimated these countries' cumulative contributions to imports and exports of 190 agricultural products for the period 1961-2017. Crop trade has increased global land and partial fertilizer nitrogen productivities in terms of protein production, which equalled savings of 2,270 Mha cropland and 480 Tg synthetic fertilizer nitrogen over the analysed period. However, crop trade decreased global cropland productivity when productivity is expressed on an energy (per calorie) basis. Agricultural trade has generally moved towards optimality, that is, has increased global land and nitrogen use efficiencies during 1961-2017, but remains at a relatively low level. Overall, mixed impacts of trade on resource use indicate the need to rethink trade patterns and improve their optimality.

Detection of functional networks within white matter using independent component analysis.

Spontaneous fluctuations in MRI signals from gray matter (GM) in the brain are interpreted as originating from variations in neural activity, and their inter-regional correlations may be analyzed to reveal functional connectivity. However, most studies of intrinsic neuronal activity have ignored the spontaneous fluctuations that also arise in white matter (WM). In this work, we explore spontaneous fluctuations in resting state MRI signals in WM based on spatial independent component analyses (ICA), a data-driven approach that separates signals into independent sources without making specific modeling assumptions. ICA has become widely accepted as a valuable approach for identifying functional connectivity within cortex but has been rarely applied to derive equivalent structures within WM. Here, BOLD signal changes in WM of a group of subjects performing motor tasks were first detected using ICA, and a spatial component whose time course was consistent with the task was found, demonstrating the analysis is sensitive to evoked BOLD signals in WM. Secondly, multiple spatial components were derived by applying ICA to identify those voxels in WM whose MRI signals showed similar temporal behaviors in a resting state. These functionally-related structures are grossly symmetric and coincide with corresponding tracts identified from diffusion MRI. Finally, functional connectivity was quantified by calculating correlations between pairs of structures to explore the synchronicity of resting state BOLD signals across WM regions, and the experimental results revealed that there exist two distinct groupings of functional correlations in WM tracts at rest. Our study provides further insights into the nature of activation patterns, functional responses and connectivity in WM, and support previous suggestions that BOLD signals in WM show similarities with cortical activations and are characterized by distinct underlying structures in tasks and at rest.

Identification of a Novel Mutation in SASH1 Gene in a Chinese Family With Dyschromatosis Universalis Hereditaria and Genotype-Phenotype Correlation Analysis.

Dyschromatosis universalis hereditaria (DUH) is a rare genodermatosis characterized by mottled hyperpigmented and hypopigmented macules. SASH1 and ABCB6 have been identified as the causative genes for this disorder. We performed whole exome sequencing on a Chinese family with DUH and genotype-phenotype correlation analysis in DUH and lentiginous phenotype patients. A novel heterozygous missense mutation p.Q518P in SASH1 gene was detected in this family. A majority of patients with SASH1 mutations presented as a distinct clinical phenotype clearly different from that in patients with ABCB6 mutations. Our findings further enrich the reservoir of SASH1 mutations in DUH. The clinical phenotypic difference between SASH1 and ABCB6 variants is suggestive of a close phenotype-genotype link in DUH.

Annular epidermolytic ichthyosis with palmoplantar keratosis: a unique phenotype associated with interfamilial phenotypic heterogeneity.

BACKGROUND: Annular epidermolytic ichthyosis (AEI) is a rare autosomal dominant ichthyosis that was recently described in 10 separate families in the English literature. There are no reports on the phenotypic heterogeneity of AEI. OBJECTIVES: We investigated, for the first time, a large Chinese AEI pedigree exhibiting interfamilial phenotypic heterogeneity. MATERIALS AND METHODS: We collected clinical data and DNA from the members of the family, and skin lesions were obtained from two patients with different phenotypes. Skin imaging examinations were performed. Whole-exome sequencing (WES) and Sanger sequencing were used to detect gene mutations. RESULTS: The characteristic features of granular layer degeneration in the two biopsies were verified via histological methods. The missense mutation c.1436T > C in KRT1 was detected in all nine patients. CONCLUSION: This study demonstrates that AEI may present with different clinical phenotypes and that mutation analysis for suspected cases is necessary to obtain a precise diagnosis.

Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype-Phenotype: A Correlation Analysis.

BACKGROUND: This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients. METHODS: Whole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ 2- and Fisher's tests were used to analyze the genotype-phenotype correlations. RESULTS: (1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype-phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021). CONCLUSIONS: This study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling.

Subsets of T lymphocytes in the lesional skin of pityriasis rosea.

BACKGROUND: Pityriasis rosea is a common papulosquamous disorder. However, its etiology and pathogenesis remain unclear. OBJECTIVE: We investigate the types of inflammatory cells infiltrating the lesional skin of pityriasis rosea and demonstrate whether T-cell-mediated immunity is involved in the pathogenesis of this condition or not. METHODS: The biopsies were taken from the lesional skin of 35 cases of patients diagnosed with pityriasis rosea. The specimens were prepared in paraffin sections, then submitted to routine immunohistochemistry procedures using monoclonal antibodies directed against CD3, CD4, CD8, CD20 and CD45RO and horseradish peroxidase-labeled goat anti-human antibodies. The positive sections were determined by the ratio and staining intensity of positive inflammatory cells. RESULTS: The mean score of positive CD3, CD4, CD8, and CD45RO staining was respectively 3.74±3.88, 5.67±4.40, 2.94±3.42 and 7.68±4.33 in these pityriasis rosea patients (P<0.001). The percentage of positive staining was 54.29% (19/35), 69.7% (23/33), 40% (14/35) and 79.41% (27/34) (P<0.05). However, the staining of CD20 was negative in all samples. The mean score of CD3 staining in patients with time for remission ≤60 days (4.90±4.21) was higher than that in patients with time for remission >60 days (2.00±2.5) (P<0.05), whereas no statistical difference in the mean score of CD4, CD8 and CD45RO staining was observed. study liMitations: The sample size and the selected monoclonal antibody are limited, so the results reflect only part of the cellular immunity in the pathogenesis of pityriasis rosea. CONCLUSION: Our findings support a predominantly T-cell mediated immunity in the development of pityriasis rosea.

Subsets of T lymphocytes in the lesional skin of pityriasis rosea

Abstract: Background: Pityriasis rosea is a common papulosquamous disorder. However, its etiology and pathogenesis remain unclear. Objective: We investigate the types of inflammatory cells infiltrating the lesional skin of pityriasis rosea and demonstrate whether T-cell-mediated immunity is involved in the pathogenesis of this condition or not. Methods: The biopsies were taken from the lesional skin of 35 cases of patients diagnosed with pityriasis rosea. The specimens were prepared in paraffin sections, then submitted to routine immunohistochemistry procedures using monoclonal antibodies directed against CD3, CD4, CD8, CD20 and CD45RO and horseradish peroxidase-labeled goat anti-human antibodies. The positive sections were determined by the ratio and staining intensity of positive inflammatory cells. Results: The mean score of positive CD3, CD4, CD8, and CD45RO staining was respectively 3.74±3.88, 5.67±4.40, 2.94±3.42 and 7.68±4.33 in these pityriasis rosea patients (P<0.001). The percentage of positive staining was 54.29% (19/35), 69.7% (23/33), 40% (14/35) and 79.41% (27/34) (P<0.05). However, the staining of CD20 was negative in all samples. The mean score of CD3 staining in patients with time for remission ≤60 days (4.90±4.21) was higher than that in patients with time for remission >60 days (2.00±2.5) (P<0.05), whereas no statistical difference in the mean score of CD4, CD8 and CD45RO staining was observed. study liMitations: The sample size and the selected monoclonal antibody are limited, so the results reflect only part of the cellular immunity in the pathogenesis of pityriasis rosea. Conclusion: Our findings support a predominantly T-cell mediated immunity in the development of pityriasis rosea.

Voxel-wise detection of functional networks in white matter.

Functional magnetic resonance imaging (fMRI) depicts neural activity in the brain indirectly by measuring blood oxygenation level dependent (BOLD) signals. The majority of fMRI studies have focused on detecting cortical activity in gray matter (GM), but whether functional BOLD signal changes also arise in white matter (WM), and whether neural activities trigger hemodynamic changes in WM similarly to GM, remain controversial, particularly in light of the much lower vascular density in WM. However, BOLD effects in WM are readily detected under hypercapnic challenges, and the number of reports supporting reliable detections of stimulus-induced activations in WM continues to grow. Rather than assume a particular hemodynamic response function, we used a voxel-by-voxel analysis of frequency spectra in WM to detect WM activations under visual stimulation, whose locations were validated with fiber tractography using diffusion tensor imaging (DTI). We demonstrate that specific WM regions are robustly activated in response to visual stimulation, and that regional distributions of WM activation are consistent with fiber pathways reconstructed using DTI. We further examined the variation in the concordance between WM activation and fiber density in groups of different sample sizes, and compared the signal profiles of BOLD time series between resting state and visual stimulation conditions in activated GM as well as activated and non-activated WM regions. Our findings confirm that BOLD signal variations in WM are modulated by neural activity and are detectable with conventional fMRI using appropriate methods, thus offering the potential of expanding functional connectivity measurements throughout the brain.

Novel mutations in Chinese Han patients with tuberous sclerosis complex: Case series and review of the published work.

Tuberous sclerosis complex (TSC) is an autosomal dominant genetic disease characterized by hamartomas in multiple organ systems. This study was performed in one familial and two sporadic cases with TSC. Two novel mutations (c.1884_1887delAAAG and c.5266A>G) and two previously reported mutations (c.4258_4261delTCAG and c.1960G>C) were identified by direct DNA sequencing. Of the four mutations, c.1884_1887delAAAG and c.1960G>C were found in a family and identified in the same allele by TA cloning sequencing. However, c.1960G>C was reported to be non-pathogenic. Furthermore, correlations between genotypes and phenotypes of Chinese Han patients since 2014 were performed by paired χ2 -tests in our published work review, which has not been reported. The results showed that patients with TSC2 mutations had a higher frequency of mental retardation and there were no significant differences of seizures and skin lesions with TSC1 mutations. Genetically, they had a higher frequency of familial inheritance.

Exome-wide association study identifies four novel loci for systemic lupus erythematosus in Han Chinese population.

OBJECTIVES: Systemic lupus erythematosus (SLE) is a chronic autoimmune disease of considerable genetic predisposition. Genome-wide association studies have identified tens of common variants for SLE. However, the majority of them reside in non-coding sequences. The contributions of coding variants have not yet been systematically evaluated. METHODS: We performed a large-scale exome-wide study in 5004 SLE cases and 8179 healthy controls in a Han Chinese population using a custom exome array, and then genotyped 32 variants with suggestive evidence in an independent cohort of 13 246 samples. We further explored the regulatory effect of one novel non-coding single nucleotide polymorphism (SNP) in ex vivo experiments. RESULTS: We discovered four novel SLE gene regions (LCT, TPCN2, AHNAK2 and TNFRSF13B) encompassing three novel missense variants (XP_016859577.1:p.Asn1639Ser, XP_016859577.1:p.Val219Phe and XP_005267356.1:p.Thr4664Ala) and two non-coding variants (rs10750836 and rs4792801) with genome-wide significance (pmeta <5.00×10-8). These variants are enriched in several chromatin states of primary B cells. The novel intergenic variant rs10750836 exhibited an expression quantitative trait locus effect on the TPCN2 gene in immune cells. Clones containing this novel SNP exhibited gene promoter activity for TPCN2 (P=1.38×10-3) whose expression level was reduced significantly in patients with SLE (P<2.53×10-2) and was suggested to be further modulated by rs10750836 in CD19+ B cells (P=7.57×10-5) in ex vivo experiments. CONCLUSIONS: This study identified three novel coding variants and four new susceptibility gene regions for SLE. The results provide insights into the biological mechanism of SLE.

Quantitative Analysis of Intracellular Motility Based on Optical Flow Model.

Analysis of cell mobility is a key issue for abnormality identification and classification in cell biology research. However, since cell deformation induced by various biological processes is random and cell protrusion is irregular, it is difficult to measure cell morphology and motility in microscopic images. To address this dilemma, we propose an improved variation optical flow model for quantitative analysis of intracellular motility, which not only extracts intracellular motion fields effectively but also deals with optical flow computation problem at the border by taking advantages of the formulation based on L1 and L2 norm, respectively. In the energy functional of our proposed optical flow model, the data term is in the form of L2 norm; the smoothness of the data changes with regional features through an adaptive parameter, using L1 norm near the edge of the cell and L2 norm away from the edge. We further extract histograms of oriented optical flow (HOOF) after optical flow field of intracellular motion is computed. Then distances of different HOOFs are calculated as the intracellular motion features to grade the intracellular motion. Experimental results show that the features extracted from HOOFs provide new insights into the relationship between the cell motility and the special pathological conditions.

Nonrigid Registration of Prostate Diffusion-Weighted MRI.

Motion and deformation are common in prostate diffusion-weighted magnetic resonance imaging (DWI) during acquisition. These misalignments lead to errors in estimating an apparent diffusion coefficient (ADC) map fitted with DWI. To address this problem, we propose an image registration algorithm to align the prostate DWI and improve ADC map. First, we apply affine transformation to DWI to correct intraslice motions. Then, nonrigid registration based on free-form deformation (FFD) is used to compensate for intraimage deformations. To evaluate the influence of the proposed algorithm on ADC values, we perform statistical experiments in three schemes: no processing of the DWI, with the affine transform approach, and with FFD. The experimental results show that our proposed algorithm can correct the misalignment of prostate DWI and decrease the artifacts of ROI in the ADC maps. These ADC maps thus obtain sharper contours of lesions, which are helpful for improving the diagnosis and clinical staging of prostate cancer.